Beckman Coulter CEQ 8000, User Manual

Page: 178 / 382

Sequence Analysis Procedures
164 CEQ™ 8000 Genetic Analysis System
Perform Sequence-based Trimming
Select this check box to enable Sequence-based trimming.
Vector/Other Sequence Files
Press to select a reference sequence. It must be in the .fasta format and stored in
an accessible folder. Press to remove a previously selected reference sequence.
There is no practical limit on the number of .fasta reference sequences that
can be used. However, larger files (i.e. greater than 200 Kbase) will increase
processing time.
Max. # of Vector/Other Sequences
Set the number of contaminant sequences to be reported in the result. This determines
the number of subsequences with the highest goodness of alignment scores that will be
reported.
Min. Substring Length
Set the minimum substring length. Only the subsequences that meet or exceed this
length will be trimmed from the result.
Distance from End
Set the distance from the end of the sequence and contaminant for automatic removal.
As shown below, the Distance from End was set to 5. So, the entire subsequence, from
the start of the sequence to the end of the contaminant sequence, was trimmed.
AACGACGGCCAGTGCCAAGCTTGGGGAGATTAATCGTGAGCGCCTAT
Enable Internal Matches
Enable this check box to allow trimming within the sequence.
Quality Values
Quality Values are another measure of the probability of correctness of a called base
and are used specifically for sequences assembled in PHRAP . They allow for more
discriminating assessment of the bases called in the higher quality portion of the data
(data with an error rate of
less than one in one hundred). Quality Values aid in the
assembly of multiple sequences in PHRAP or any program that performs
quality-weighted sequence alignment or primer design.
Preventing Alignment Problems
To prevent alignment problems caused by occasional high quality bases appearing in
the lower quality 3’ end of a called sequence, it is suggested that you trim the 3’ end of
the sequence.
Bases at the 3’ end of the sequence should be trimmed when: