background image

Sequence Analysis Procedures

164

CEQ™ 8000 Genetic Analysis System

Perform Sequence-based Trimming

Select this check box to enable Sequence-based trimming. 

Vector/Other Sequence Files

Press 

 to select a reference sequence. It must be in the .fasta format and stored in 

an accessible folder. Press 

 to remove a previously selected reference sequence.

There is no practical limit on the number of .fasta reference sequences that
can be used. However, larger files (i.e. greater than 200 Kbase) will increase
processing time.

Max. # of Vector/Other Sequences

Set the number of contaminant sequences to be reported in the result. This determines 
the number of subsequences with the highest goodness of alignment scores that will be 
reported.

Min. Substring Length

Set the minimum substring length. Only the subsequences that meet or exceed this 
length will be trimmed from the result.

Distance from End

Set the distance from the end of the sequence and contaminant for automatic removal. 
As shown below, the Distance from End was set to 5. So, the entire subsequence, from 
the start of the sequence to the end of the contaminant sequence, was trimmed.

AACGACGGCCAGTGCCAAGCTTGGGGAGATTAATCGTGAGCGCCTAT

Enable Internal Matches

Enable this check box to allow trimming within the sequence.

Quality Values

Quality Values

 are another measure of the probability of correctness of a called base 

and are used specifically for sequences assembled in 

PHRAP

. They allow for more 

discriminating assessment of the bases called in the higher quality portion of the data 
(data with an error rate of

 

less

 than one in one hundred). Quality Values aid in the 

assembly of multiple sequences in 

PHRAP

 or any program that performs 

quality-weighted sequence alignment or primer design.

Preventing Alignment Problems

To prevent alignment problems caused by occasional high quality bases appearing in 
the lower quality 3’ end of a called sequence, it is suggested that you trim the 3’ end of 
the sequence. 

Bases at the 3’ end of the sequence should be trimmed when:

Содержание CEQ 8000

Страница 1: ...TM A16637 AA April 2004 Beckman Coulter Inc 4300 North Harbor Boulevard Fullerton CA 92834 3100 Copyright 2004 Beckman Coulter Inc CEQ 8000 Genetic Analysis System User s Guide...

Страница 2: ...lication may be reproduced transcribed transmitted or translated into any language in any form by any means without the written permission of Beckman Coulter Inc The software is copyrighted and may no...

Страница 3: ...sport and Plate Holders 4 Sample Plate 5 Buffer Plate with Buffer Evaporation Cover 5 Wetting Tray 5 Gel Waste Bottle 6 Power Switch 6 Gel Pump Gel Cartridge Access Cover 6 Gel Pump Gel Cartridge and...

Страница 4: ...Status Monitor 51 Window Selection Tabs 53 Data Monitor Window 53 Direct Control Window 54 Log Window 57 Instrument Data Window 58 Sequence Analysis Module 59 Main Window 60 Menu Bar Options 62 File...

Страница 5: ...5 Creating a Database 116 User s Database Template 116 Creating and Naming a Project Folder 116 Setting up a Sample 116 Starting the Sample Setup Module 116 Setting up the Sample Plate 116 Running a S...

Страница 6: ...ming Log 137 Lock 139 View Summary 139 Run Procedures 141 Opening the Run Module 141 Defining System Preferences 141 Running a Sample Plate 141 Database Size 141 Gel Re estimation Feature 142 Gel Re E...

Страница 7: ...ng Bases 175 Inserting Bases in the Analyzed Data Pane 175 Inserting Bases in the Base Sequence Pane 176 Changing Bases in the Analyzed Data Pane 176 Changing Bases in the Base Sequence Pane 176 Delet...

Страница 8: ...tion 199 Sequence Result Export 200 Sequence Export File Types 201 Customizing Filename Extension 204 Exporting Data to a Third Party Package 204 CEQuence Investigator Procedures 207 Creating a Refere...

Страница 9: ...egression 247 Interpolation and Linear Regression 247 STR Locus Tag Editor Allele ID Criteria 248 SNP Locus Tag Editor 253 Result Set Filtering 255 Accessing the Result Set View 255 Applying Exclusion...

Страница 10: ...ays 293 Editing X scale type 293 Editing the X axis 293 Editing the Y axis 294 Editing the Pane Count or the Pane Width 294 Editing the number of dyes displayed on the Graph 295 Exporting Results 296...

Страница 11: ...he Capillaries with Gel 333 Purging the Manifold 333 Performing an Optical Alignment 333 Viewing or Changing Capillary Information 334 Viewing or Changing Gel Buffer Information 334 Removing and Repla...

Страница 12: ...ray 360 Disposal of the Gel Waste Bottle 361 Consumable Items List 362 Materials Required but not Supplied 365 Diagnostics 367 Re Initializing the System 367 Homing the Plates and or Gel Pump 367 View...

Страница 13: ...basis It also provides procedures to perform the tasks involved in analyzing managing samples and sample data Routine Maintenance provides routine maintenance procedures and biological waste disposal...

Страница 14: ...ler or Beckman Coulter be sure to have your registration material instrument serial number and soft ware version number available For future reference record this information here Instrument Serial Nu...

Страница 15: ...ent length analysis is performed using dye labeled primers The CEQ 8000 accepts up to 96 four color samples in a microplate Each row of eight samples sample set containing labeled DNA fragments is aut...

Страница 16: ...ironment for the Capillary Temperature Control and allows access to the capillary array Capillary Array The capillary array used to produce raw data for sequencing and fragment analysis is 33 centimet...

Страница 17: ...laries to laser excitation the external polyimide coating of the capillaries has been removed for this purpose When the capillary array is not installed e g during shipping and storage the Manifold Pl...

Страница 18: ...Assembly Back View Sample Transport and Plate Holders The Sample Transport Figure 4 contains the Plate Holders which are used to hold the Sample Plate Buffer Plate w Buffer Evaporation Cover and Wett...

Страница 19: ...uffer Plate position of the Sample Transport As the CEQ advances through the Sample Plate during a run the evaporation cover is pushed back just far enough to expose the next row of buffer wells to be...

Страница 20: ...used to capture and store the waste gel that is pushed out of the manifold during the purge function The bottle can hold the equivalent of 25 gel cartridges Periodic observation of the gel level in t...

Страница 21: ...nd Fragment Analysis When full the cartridge contains a sufficient amount of gel for 12 runs 96 templates See Table 75 on page 362 Gel Pump Plug When the gel cartridge is not installed e g during ship...

Страница 22: ...d HV high voltage PWR Green when power is supplied to the CEQ Off when no power is supplied LASER Green when the lasers are turned on during a run Off when the lasers are turned off HV Green when the...

Страница 23: ...al or automatic pre programmed control of the system and for data capture and basic data analysis User Interface The Main Menu is shown in Figure 10 This window provides access to all modules of the C...

Страница 24: ...sis Module Use the Sequence Analysis module to view analyze compare manipulate and print base sequence data produced by sample runs CEQuence Investigator Module This icon accesses the CEQuence Investi...

Страница 25: ...the symbol WARNING This icon accompanies text and or other international symbols dealing with hazards to personnel When present it indicates that a potential hazard to your personal safety exists if i...

Страница 26: ...NING icon will accompany this symbol HOT SURFACE Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from heated faces or other appendages on the outside o...

Страница 27: ...and earth grounded DO NOT use a three to two wire plug adapter DO NOT use a two wire extension cord or a two wire multiple outlet power strip Disconnect power to the system before performing maintena...

Страница 28: ...aser Assembly has no user serviceable parts Service of the Laser Assembly is restricted to certified Beckman Coulter Field Engineers During normal operation of the system laser light is not accessible...

Страница 29: ...OPEN OR REMOVED AVOID EXPOSURE approximate location AVOID EXPOSURE LASER LIGHT IS EMITTED FROM THIS APERATURE approximate location cosmetic panel removed 900468e AI 900485e AI rear approximate locatio...

Страница 30: ...se calling accuracy In some cases significant noise will appear in the measured results Will return to normal performance once exposure is removed Re run sample Move location of the product by several...

Страница 31: ...and software commands in each module that are used in controlling the system The module titles are Sample Setup Module Run Module Sequence Analysis Module CEQuence Investigator Module Fragment Analys...

Страница 32: ...n contains the 96 well plate locations of the samples as well as the method assigned to each sample The capillary array must run the same separation parameters across eight samples one column at a tim...

Страница 33: ...Sample Setup Module User s Guide 19 Main Window The main window of this module is shown in Figure 13 and described in Table 2 Figure 13 Sample Setup Module Main Window E A B C I J G K H D F...

Страница 34: ...t ID will appear in these fields See Naming Samples and Assigning Subject IDs on page 128 F The Plate Status indicator identifies if the plate is empty has been edited or saved G Sample Plate containi...

Страница 35: ...samples with different descriptions are selected Figure 14 Notes Window Property Sets Listbox Property sets are groups of properties that can be applied to a sample s such as Vector Host and Primer u...

Страница 36: ...sed to Enable disable the Automatic Analysis mode When enabled this mode causes the CEQ to automatically analyze each previously selected sample after it has run using the Analysis Parameter Set selec...

Страница 37: ...view Used to display a facsimile of a hardcopy printout of the active sample plate Print Setup Used to define printer properties Print Pull right menu used to print a detailed report of the active sam...

Страница 38: ...ed to select a method to edit Selected Method Used to view or edit the currently selected method for a specific sample or sample set from the dialog box shown below Auto Fill Method Name Used to selec...

Страница 39: ...e Item Description Start Invokes the Run module and loads the active sample plate Item Description Next Toggles between open sample plates Close Used to close the active sample plate or sample plate s...

Страница 40: ...e sample plate Copy Used to duplicate text in one or more cells of the sample plate Paste Used to insert copied or cut items at the cursor insertion point Unlock Indicates that the selected sample pla...

Страница 41: ...nt specific topics in the CEQ Help file and search for information by topic index entry and or keyword Context Sensitive Help Used to open the Help file related to a specific menu option Run Sample Pl...

Страница 42: ...Program Description 28 CEQ 8000 Genetic Analysis System...

Страница 43: ...he progress of a sample plate Viewing and changing display options Specifying a sample set buffer set or wetting tray position Specifying the capillary holding temperature Denaturing a sample Aligning...

Страница 44: ...pecified system name B The Menu Bar is a list of the menu options see Menu Bar Options on page 31 C The Toolbars contain the icons that execute pre defined functions see Toolbar Icons on page 45 D The...

Страница 45: ...in the Display Area H The Status Bar displays messages such as Currently Active Database The active database name will be displayed Pause to Load If Pause to load has been selected the wait time will...

Страница 46: ...ifier System Preferences Used to view and or change the System Name Operator Name Project Name and Dye Names for Fragment Analysis and or to activate or deactivate the alarms Print Setup Used to defin...

Страница 47: ...to select the toolbars to display in the Run module window Status Bar Toggles between displaying not displaying the Status Bar Status Monitor Toggles between displaying displaying the Status Monitor...

Страница 48: ...Direct Control Menu Item Description Unload Plates Used to move the plate holder to the Load position at the front of the instrument to load or unload plates Plate Position This dialog box is used to...

Страница 49: ...en at the end of each sample plate or when cancelled Denature Samples Used to initiate the denaturing of samples Optical Alignment Used to align the lasers with the detection windows of the eight capi...

Страница 50: ...d or remaining DNA fragments before the next separation process Table 14 Run Module Tools Menu Item Description Autoscroll Used to scale all data to the last 10 minutes of the run on the X axis and co...

Страница 51: ...ne by clicking on Apply Double clicking the left mouse button in the selected pane also brings up this dialog box View Last Analysis Used to open and display the most recently analyzed sample set If t...

Страница 52: ...plate will stop the currently running sample plate immediately Skip current sample set will skip the currently running sample set OR Stop after current sample set completes will stop the run after the...

Страница 53: ...r the first time and an optical alignment has been performed The baseline trace should be low and relatively flat less than 6000 counts If Autosave is selected from the dialog box baseline data will b...

Страница 54: ...ate Only Causes the program to only list items related to a running sample plate in the Log Window Freeze Log Used to freeze the display in the Log Window Freezing the log data does not stop the colle...

Страница 55: ...information requested and then install the array Release Capillary Array Used to remove the current capillary array To install a new capillary array select the Replace capillary array radio button To...

Страница 56: ...Information Used to view the part number lot number for the gel and or buffer the date and time of gel cartridge installation and the number of hours the cartridge has been on the instrument Install...

Страница 57: ...cartridge or preparing the system for short or long term storage When selected the following confirmation dialog will open Select OK to continue Enter the requested information and then Select Instal...

Страница 58: ...place or re fill the wetting tray When selected the following confirmation dialog will open Select the position where you wish the capillaries to be immersed after the wetting tray is replaced If you...

Страница 59: ...ables describe the function of each of the toolbar icons Item Description Help Topics Used to select and print specific topics in the Help file and or search for information by topic index entry and o...

Страница 60: ...on of the display monitor to the original default shipped with the instrument Run Sample Plate Used to open and execute a specific sample plate Pause Used to pause a running sample plate Stop Used to...

Страница 61: ...enaturing of samples Optical Alignment Used to align the lasers with the detection windows of the eight capillaries Data can be saved and viewed in the Sequence Analysis module Plate Position Used to...

Страница 62: ...of data just the display of data Monitor Baseline Baseline monitoring displays the baseline data trace To ensure that the optics are working correctly and that the capillaries are clean view the basel...

Страница 63: ...ane selected in the Display Area Print Preview Used to display a facsimile of a hardcopy printout of the active sample plate Icon Description A red The color red is the default color assigned to the A...

Страница 64: ...assigned to Dye 1 in the Fragment Data pane and D1 is the default name D2 black The color black is the default color assigned to Dye 2 in the Fragment Data pane and D2 is the default name D3 green The...

Страница 65: ...e User s Guide 51 Status Monitor The Status Monitor displays the state of the current run Figure 32 shows the status monitor and Table 25 describes the areas Figure 32 Run Module Status Monitor Displa...

Страница 66: ...Lists the sample plate sample names and the method being used Device Displays the condition or value of devices or parameters Amp Shows the approximate overall microamperes A and voltage used during...

Страница 67: ...e Display Area by selecting the Data Monitor tab The window displays information associated with a sample s analysis Figure 33 Run Module Data Monitor Window Table 26 Run Module Data Monitor Window De...

Страница 68: ...Control window is shown in Figure 34 This window is accessed in the Display Area by selecting the Direct Control tab This window contains hot areas and function buttons that perform some of the disti...

Страница 69: ...ers shown on the window in Figure 34 represent the locations of the hot areas in the Direct Control window Each hot area when selected initiates a unique Direct Control task Table 27 lists the tasks a...

Страница 70: ...ocess E Install Release Gel Cartridge Used to release and or install a gel cartridge F Denature Samples Used to initiate the denaturing of samples G Plate Position Used to select the plate or tray pos...

Страница 71: ...r a sample plate run Figure 35 Run Module Log Window Table 28 Run Module Log Window Descriptions Item Description A Window Selection Tab Select this tab to access the Log window B Freeze Log Used to f...

Страница 72: ...the eight capillaries and the voltage level of the instrument for the current run Figure 36 Run Module Instrument Data Window Table 29 Run Module Log Window Descriptions Item Description A Current an...

Страница 73: ...tical Scan Data Baseline Data Quality Parameters These types of data cannot be manipulated This module accepts raw data and analyzed data Editing and re analysis functions provide the capability to ve...

Страница 74: ...Description A The Title Bar showing the module name CEQ Sequence Analysis and the currently active sample B The Menu Bar is a list of the menu options see Menu Bar Options on page 62 C The Toolbar con...

Страница 75: ...ctive sample Raw Data Displays the raw data for the active sample Current Displays the current data for the active sample Voltage Displays voltage data for the active sample Compare Data Used to compa...

Страница 76: ...sults and Sample Plate Results Close Closes the open sample Close Tab Closes the active tab Save Saves existing data Save As Used to save data to a new name Import Used to locate data to be imported S...

Страница 77: ...what panes will be displayed when a sample is first opened show the Report Format dialog box when Print Report is selected from the File menu open all associated results that belong to a sample when...

Страница 78: ...selected sample plate Print Report Used to print the report Print Selected Pane Used to print the selected pane Print Desktop Used to print the desktop application or main window as defined in the Pre...

Страница 79: ...e Status Bar Analyzed Data Displays the data that has been analyzed for the active sample Base Sequence Displays a text view of the bases from the analyzed data for the active sample Raw Data Displays...

Страница 80: ...quence analysis parameters used to produce the given analyzed data The fields in this dialog box are read only and are not editable This item is not available for data that has not yet been analyzed R...

Страница 81: ...e data is scaled to its true values Use this item to turn autoscaling on or off Base Spacing Used to set the space between base sequence text in groups of 0 3 5 or 10 Base Synch With both the Analyzed...

Страница 82: ...y Options Invokes the Display Options dialog box used to modify any or all of the following parameters Title X Axis Options Y Axis Options Dye Traces Current Traces Colors Quality Parameters See immed...

Страница 83: ...nce Analysis Module User s Guide 69 Heterozygote Display Color Opens the Heterozygote Display Colors dialog This is used to change the color of the heterozygotes in the base sequence pane Item Descrip...

Страница 84: ...ts When selected the current Working Parameters dialog box is displayed The analysis begins when OK is pressed Stop Terminates the executing analysis Working Analysis Parameters Used to view and or ch...

Страница 85: ...alog box is displayed Select the appropriate analysis parameters or edit an existing parameter set and click OK batch processing begins and a window similar to the one below is displayed Reanalyze Bat...

Страница 86: ...en analyzed Use Resume Batch Processing to continue the analysis Resume Batch Processing Used to resume a batch analysis after it has been paused Third Party Analysis Used to launch the third party an...

Страница 87: ...functions of each of the toolbar icons Item Description Cascade Cascades the open windows Tile Horizontally Tiles the windows in a horizontal orientation Tile Vertically Tiles the windows in a vertic...

Страница 88: ...0 Sequence Analysis Module Toolbars Standard Toolbar Data Toolbar Table 39 Table 38 Sample View Toolbar Table 40 Base Sequence Toolbar Sample Plate Toolbar Figure 46 Figure 47 Batch Control Toolbar Ta...

Страница 89: ...e Used to insert one or more copied or cut bases Undo Used to undo the last action performed Redo Used to redo the last undo action Apply Quality based Trimming Use this option to commit to the Qualit...

Страница 90: ...ence against the current alignment settings Base Sequence Toolbar Used to view the base sequence toolbar that allows you to search for text and ambiguity codes View Sample Plate Toolbar Used to view t...

Страница 91: ...data is scaled to its true values Use this item to turn autoscaling on or off Base Spacing Used to set the space between base sequence text in groups of 0 3 5 or 10 Base Synch With both the Analyzed...

Страница 92: ...ys a text view of the bases from the analyzed data for the active sample Raw Data Displays the raw data for the active sample Current Displays the current data from the capillary arrays for the active...

Страница 93: ...in the Analyzed Data pane C black Black is the default indicator assigned to the Cytosine C nucleotide bases in the Analyzed Data pane G green The color green is the default color assigned to the Guan...

Страница 94: ...se Resume Batch Processing to continue the analysis Resume Used to resume a batch analysis after it has been paused Skip Sample While performing a batch analysis use this item to pass over the sample...

Страница 95: ...down menu Valid samples appear as filled wells Wells not specified as samples appear dark or empty Click on the samples to open or export To view the name of a sample and associated result position t...

Страница 96: ...i e not IUB codes check the Exact Match checkbox To search for text within a range highlight the range of interest in the base sequence pane and check the Search Highlighted Range checkbox Character...

Страница 97: ...Module User s Guide 83 The IUB codes to enter when the Exact Match check box is unchecked are listed below N G A T or C V G A or C B G T or C H A T or C D G A or T K G or T S G or C W A or T M A or C...

Страница 98: ...84 CEQ 8000 Genetic Analysis System...

Страница 99: ...vides a detailed report of the differences A number of tools are provided for inspecting and editing the data before the final report is generated The Navigator Toolbar allows you to jump to points of...

Страница 100: ...le name the active document name and has the standard minimize maximize and close icons at the top right of the window B Menu Bar The Menu Bar contains a list of drop down menu items that display vari...

Страница 101: ...nt Panes Displays the text alignment results including the following elements Base and codon numbering reference and consensus amino acid translations reference sequence sample sequence s consensus se...

Страница 102: ...current document as a text txt or a protein file pro Preferences Sets the preferences for the CEQuence Investigator Properties Used to view the properties of the current document Report Format Sets t...

Страница 103: ...that contain an end base in the sample sequence base call text Search Used to search Forward and Backward for the attributes or text specified in the Navigator toolbar Restore To Original Restores th...

Страница 104: ...Sequences Reference Amino Acid Translation Toggles view hide the Reference Amino Acid Translation Consensus Amino Acid Translation Toggles view hide the Consensus Amino Acid Translation Differences T...

Страница 105: ...ened The information in Table 49 and Table 50 describe the function of each of these buttons Item Description Help Topics Used to select and print specific topics in the CEQ 2000 Help file and or sear...

Страница 106: ...for a reference file from a Windows folder or disk and then prompts for one or two sequence results from the current working database Open Opens an existing compared sequence result Save Saves the ac...

Страница 107: ...ginal Restores the compared sequence result to its original state all changes will be removed Unzoom all Displays both sequence traces in their entirety Toggle Sequences Displays or hides the sequence...

Страница 108: ...se text background in the specified dye colors when selected List Help Topics Opens CEQ System Help contents Display Context Sensitive Help Click on this button first and then on a menu item toolbar b...

Страница 109: ...on A red The color red is the default color assigned to the Adenine A nucleotide in the Data view C black The color black is the default color assigned to the Cytosine C nucleotide in the Data view G...

Страница 110: ...96 CEQ 8000 Genetic Analysis System...

Страница 111: ...calibration and locus tags to be used for processing data The analysis of data can be performed manually or automatically The editing and re analysis functions provide the capability to verify the acc...

Страница 112: ...ins the icons that execute pre defined functions see Toolbar Icons on page 104 D Clicking on a dye color in the Dye Colors box brings up the Color dialog box Change the dye color displayed for that pa...

Страница 113: ...udy Manager to view and select all Studies saved to the database Save Study Used to save the new or edited Study Save Study As Used to save the current Study with a new name Add Raw Data to Study Used...

Страница 114: ...ample is selected select to have the system display a warning message before resetting all manually included or excluded bins during an AFLP analaysis select to have the system display a warning dialo...

Страница 115: ...Editor Opens a dialog that helps create the LocusList txt file used for the Genotype Summary View GSV Genotype Summary The Genotype Summary View grid displays a study s genotype information loci and...

Страница 116: ...As CSV Used to save the Fragment Grid as a Comma Delimited File csv Item Description Reanalyze Results Presents the options to reanalyze the results from sample data opens the Analysis Parameters dial...

Страница 117: ...sed to run a Loss of Heterozygosity Analysis Item Description New Report Opens the New Report dialog box Used to select a template and context type for the report Refresh Refreshes the display of the...

Страница 118: ...ragment Analysis module is opened The tables below describe the functions of each of the toolbar icons Item Description Help Topics Used to select and print specific topics in the Help file and or sea...

Страница 119: ...he Fragment List Result Set Used to open the Result Set View D1 red The color red is the default color assigned to Dye 1 in the Fragment Data pane and D1 is the default name D2 black The color black i...

Страница 120: ...106 CEQ 8000 Genetic Analysis System...

Страница 121: ...Filter Sets Fragment Analysis Parameters Fragment Results STR Locus Tags Methods Optical Scan Data Sample Data Sample Plates Sample Plate Results Sequence Analysis Parameters Sequence Results SNP Locu...

Страница 122: ...Window Descriptions Item Description A The Title Bar showing the module name CEQ Data Manager B The Menu Bar is a list of the menu options see Menu Bar Options on page 109 C The Toolbar contains the i...

Страница 123: ...ults or Standards Print Used to print a report of the selected item Print Setup Used to define printer properties Print Screen Pull right menu with the option to send an image of the computer desktop...

Страница 124: ...Defines the currently selected database as the default database Exit Closes the Data Manager module Item Description Cut Used to delete an item Copy Used to duplicate an item project or database Past...

Страница 125: ...up Used to make a backup copy of the selected database Restore Used to restore a previously backed up copy of a database to the Data Manager Shrink Database Use this menu option to reduce the size of...

Страница 126: ...the icons Close Closes the currently active window Item Description Help Topics Used to select and print specific topics in the Help file and or search for information by topic index entry and or key...

Страница 127: ...items projects and databases Copy Used to duplicate an item project or database Paste Used to insert one or more copied or cut items projects or databases Print Used to print a report of the selected...

Страница 128: ...114 CEQ 8000 Genetic Analysis System...

Страница 129: ...wer switch to the ON position and wait for Windows to start 3 Set the CEQ instrument power switch to the ON position 4 On the Desktop select Start Programs CEQ System Control Center or double click th...

Страница 130: ...e select Set as Working Database if desired and select OK Creating and Naming a Project Folder 8 In the Data Manager window highlight the desired database where the project will reside and select File...

Страница 131: ...d then return here Installing the Gel Waste Bottle 24 If necessary perform the procedure Replacing the Gel Waste Bottle on page 356 and then return here Preparing Plates for a Run 25 Load samples into...

Страница 132: ...te Run Confimation dialog box Figure 61 select the desired project and the side left right for each prepared sample plate and click OK Figure 61 Sample Plate Run Confirmation Dialog 29 In the Confirm...

Страница 133: ...ar Figure 63 Access Plates Dialog 31 Click Start to continue 32 Install the plate s and click the Plate Loaded check box Figure 64 for each side if applicable and then select the side to immerse the c...

Страница 134: ...System Figure 64 Capillaries Exposed Dialog 33 Click Load to continue Refer to Installing the Wetting Tray on page 328 Loading the Sample Plate on page 330 and Loading the Buffer Plate and Evap oratio...

Страница 135: ...radio button 2 Select the sample plate name described below and click OK When the Open an existing sample plate radio button is selected the Sample Plate selection dialog is activated Available sample...

Страница 136: ...does not appear in the list of available items it may be residing in another project To select the project where the sample plate resides click on the project down arrow then on the desired project Th...

Страница 137: ...ighlight the cell or cells where the sample s will reside 4 Enter the name of the sample s in the Sample Name text box and then press the Enter key 5 Enter the barcode for the plate in the Barcode tex...

Страница 138: ...ying Sample Plate Export Options on page 136 and then return here 5 Select File Save As from the menu 6 In the Save As dialog box a Select a Project Name from the drop down menu b Enter a name for thi...

Страница 139: ...once to select the row To remove the selection mouse click any sample in the grid Selecting the Entire Column Place the mouse pointer over the column label at the top of the column to be selected A s...

Страница 140: ...he first cell in the column or row to be selected 2 Press and hold down the Shift key 3 Mouse click the last cell in the column or row to be selected If using the above steps cell A1 is selected and t...

Страница 141: ...n the Ctrl key 3 Mouse click all the remaining cells for the selection 4 Release the Crtl key See Figure 72 View by Sample Name Subject ID This Menu option toggles the sample plate view between Sample...

Страница 142: ...Enter the Subject ID in the Subject ID text box and press Enter To name all wells in the plate 1 Click the Select All icon 2 Enter the name of the samples in the Sample Name text box and press the En...

Страница 143: ...will find all occurrences of the text regardless of case Check Use wildcards to include the following wildcard characters in your search The system will support the following wildcard combinations and...

Страница 144: ...regardless of case Check Use wildcards to include the following wildcard characters in your search The system will support the following wildcard combinations and The system does not support the combi...

Страница 145: ...lected Pressing the Enter key moves the focus down the table one cell at a time within the same column Refer to Figure 74 and Figure 75 Figure 74 Property Set Editor Figure 75 Sample Property Sets Dia...

Страница 146: ...e property table Enter the new property name and value into the cells of the new row Figure 76 CEQ Sample Setup Dialog To assign a pre defined property set click on the Sample Property Sets button and...

Страница 147: ...hosen the Method tab is activated and the method can be edited A method must be assigned to each named row before the sample plate can be saved If any named row is not assigned a method and a save is...

Страница 148: ...Method dialog box or continue with step 4 to make additional changes to the method 4 Select Denature from the Event list and then a Enter a duration between 0 and 180 seconds if 0 is selected there w...

Страница 149: ...the signal to noise ratio the minimum duration and the threshold above which data will be considered peaks Fragment Analysis Parameter Sets are used to process the fragment data to estimated fragment...

Страница 150: ...w Data Sequence Analysis Result Data Fragment Analysis Result Data Base Sequence Grouping and Current Trace Options selections in the Print Options dialog box and then click OK 7 If desired select the...

Страница 151: ...orted All internal trims will be replaced by the letter x Export Only If Sequence X nt The resulting sequence after trimming may be to small to be useful Use the Export Only If Sequence X nt option to...

Страница 152: ...138 CEQ 8000 Genetic Analysis System Figure 80 Report Format dialog...

Страница 153: ...late select File Lock The Notes Method and Analysis tabs are disabled when the sample plate is locked View Summary A read only window showing the attributes of the currently selected plate in tabular...

Страница 154: ...140 CEQ 8000 Genetic Analysis System...

Страница 155: ...rm the following steps 1 Select Run Start Sample Plate from the menu 2 In the Sample Plate Run Configuration dialog select a Project Name from the drop down for the Left and Right Plates and highlight...

Страница 156: ...4 Open the Data Manager module 5 Create a new database by highlighting CEQDBAS and clicking New button 6 Enter a name for the database and click OK 7 Select the new database and set it as the Working...

Страница 157: ...ill be engaged and the system will accurately determine the gel volume The dialog box in Figure 84 will be displayed Figure 84 Gel Volume Re estimation Step 2 Dialog If the gel volume is greater that...

Страница 158: ...un the plate you will be presented with the dialog box in Figure 85 Figure 85 Gel Usage Confirmation Dialog 6 Click Accept to proceed with the run If the run is selected to continue specify the sample...

Страница 159: ...main window Gel Plug Warning When the Run Module initializes it will check the gel cartridge condition If a gel plug is installed the dialog in Figure 88 is displayed The Device tab indicates the sta...

Страница 160: ...he sample plate To resume the run click the Pause button again Stopping a Sample Plate Run To stop the currently executing sample plate perform the following steps 1 Click the Stop System button from...

Страница 161: ...g the Last Analysis Performed To view the last analysis performed on the CEQ System perform the following steps 1 With a sample plate running and with Automatic Analysis selected select Tools View Las...

Страница 162: ...Run Procedures 148 CEQ 8000 Genetic Analysis System...

Страница 163: ...ce Analysis Parameters or Optical Scan Data highlight the desired item and then select OK 3 Click on the Sample View See Sample View Toolbar on page 151 toolbar icons to display the desired data Below...

Страница 164: ...mple plate result displays the Sample Plate toolbar Click on the desired sample s then click on Open The desired sample s are opened Sequence Analysis Parameters Displays the Sequence Analysis Paramet...

Страница 165: ...Click Edit in the Working Parameters dialog box 3 The Sequence Analysis Parameters Editor dialog box will open as shown in Figure 93 Icon Description Analyzed Data Displays the data that has been anal...

Страница 166: ...hanged to an N The range is 0 00 to 1 00 and the default is 0 60 If Detect Heterozygotes is checked in the Heterozygote Detection tab this field is disabled In the CEQ System Software N s are assigned...

Страница 167: ...ve a Call Score below the specified threshold will be called as N s Analysis Start Enter the time in minutes from the start of raw data to the time when data analysis is to begin The range is 0 0 to 1...

Страница 168: ...resent during the sequencing reaction and The presence of a run of a single base e g polyA in the template leads to a copying error To enable the system to attempt to identify and reduce the inclusion...

Страница 169: ...ters that the system will use to define the start of usable data when an Analysis Start time on the General tab is not entered See Figure 94 The default settings are different when the 200 Bases optio...

Страница 170: ...se This is the signal to noise ratio for significant data The range is 3 00 to 1000 00 and the default is 7 00 Minimum Duration The minimum duration is the duration in minutes that the signal to noise...

Страница 171: ...Call Threshold value remains in the text box The system will use a value of zero for the Call Threshold and will not call N s when attempting to detect heterozygotes of Average Peak Spacing Use this...

Страница 172: ...e max is dependent upon the length of the analyzed sequence for the current sample Range From Minimum If Range From is zero detection will start at the first called base The range is 0 to 2000 and the...

Страница 173: ...s clicked the dialog box in Figure 96 is shown If Automatic Alignment is checked on the General tab the options on this tab along with the information on the Alignment Parameters tab will be used for...

Страница 174: ...the path of the desired reference file or browse for a file Browse The Browse button will allow to search for Text files txt and Sequence files seq Cutoff Accuracy Enter the desired Cutoff Accuracy T...

Страница 175: ...nge is 1000 0 to 1000 0 A value of 1 0 is the default value The Mismatch text box is used for the value of a mismatch between a base position of the sequence and the alignment sequence The range is 10...

Страница 176: ...ft Edge Free and or Right Edge Free to specify that overhanging bases on the template or sequence will not be counted in the alignment score Enter the number of bases needed to constitute a substring...

Страница 177: ...0 05 0 03 0 01 The default value is Medium 5 Sequence based Trimming Tab The Sequence based trimming function allows for contaminant sequence based trimming This can be done in Batch Analysis mode or...

Страница 178: ...the end of the sequence and contaminant for automatic removal As shown below the Distance from End was set to 5 So the entire subsequence from the start of the sequence to the end of the contaminant...

Страница 179: ...open the Sequence Analysis Parameters Editor 3 Select the Quality based Trimming tab 4 Select the Ends To Be Trimmed and the Trimming Stringency 5 Click Save As and save the new parameters 6 Click OK...

Страница 180: ...Sequence Analysis Procedures 166 CEQ 8000 Genetic Analysis System Figure 100 Base Sequence and Trace Views after Quality based Trimming...

Страница 181: ...be recovered after Apply Quality based Trimming has been performed by selecting the Edit Undo menu item Performing Sequence based Trimming To setup Sequence based trimming open the Sequence Analysis...

Страница 182: ...d 1 Select the Edit Trim Based on Sequence menu item 2 The Analysis Parameters created in the steps above should be listed If not click Use Stored Parameters and select the appropriate Analysis Parame...

Страница 183: ...ce based trimming has been applied is shown in Figure 103 When selecting applying sequence based trimming quality based trimming will automatically be applied first if quality based trimming was perfo...

Страница 184: ...uences from within the sequence To exclude a subsequence from final removal right click on the subsequence and select Vector Other Subsequences and select the subsequence Only those subsequences marke...

Страница 185: ...atch Trimming Batch trimming has been added to enable the automatic trimming of a large number of results To perform Batch Trimming open the Sequence Analysis module and follow the steps outlined belo...

Страница 186: ...he required Analysis Parameters are selected in the Working Parameters dialog If not click Use Stored Parameters and select the appropriate Analysis Parameter 6 Select the Export Results check box if...

Страница 187: ...r Quality based Trimming Vector Other Subsequence Name First Base Trimmed Last Base Trimmed Enabled Length after Sequence based Trimming Exported From the Trimming Report pane you can print the grid d...

Страница 188: ...mited txt text file Format Grid Format Grid allows the user to customize the look of the data grid If rows or columns are hidden Print Grid Data will omit them However this will not affect the Exporte...

Страница 189: ...replaced by the letter x Export Only If Sequence X nt The resulting sequence after trimming may be to small to be useful Use the Export Only If Sequence X nt option to specify a minimum size that the...

Страница 190: ...g steps 1 Select Tools Edit from the menu 2 Click on a base in the analyzed data pane 3 From the Change Base dialog box select the desired base and then click OK The base is changed in both the Analyz...

Страница 191: ...Highlight the base s in the base sequence text to delete and then press the Delete key or use the Cut icon The base s is deleted in both the Base Sequence and Analyzed Data panes Specifying Base Group...

Страница 192: ...Analysis Log Occasionally the system will not be able to find the end of PCR product data even if the PCR Product option is selected You will be able to determine if this is the case by reviewing the...

Страница 193: ...Alignment Consumable General information Notes and Property set information Open the Properties dialog box by selecting File Properties when a sequence result is open See Figure 112 If no alignment ha...

Страница 194: ...s System Notes Tab Any notes associated with the sample well for the open sequence result can be viewed These notes are entered in the Sample Setup module on the Notes tab at the bottom of the main wi...

Страница 195: ...can view any property sets associated with the sample well for the open sequence result These Property Sets are defined in the Sample Setup module on the Notes tab at the bottom of the main window See...

Страница 196: ...od Tab The method event parameters used to collect the raw data for the open sequence result are shown here These parameters are defined on the Method tab in the Sample Setup module prior to running t...

Страница 197: ...user can view the sequence analysis parameter set used to analyze the open results The Analysis tab lists the Analysis Parameter Set name and the defined values for that parameter set as shown in Figu...

Страница 198: ...e user can view the alignment template information and the alignment parameters used to create the alignment of the currently open result See Figure 117 Figure 117 Analysis Tab Properties Dialog This...

Страница 199: ...the Run module See Figure 118 Figure 118 Consumables Tab Properties Dialog Setting or Changing Display Options Setting or Changing Title Properties To set or change the title of the displayed data pa...

Страница 200: ...the X Axis Options tab 3 Change any item as necessary then select Apply to continue or OK to close the Display Options dialog box Setting or Changing Y Axis Options To define the Y Axis properties of...

Страница 201: ...Data Click OK From the Run module 1 Select Tools Display Options 2 Select the Current Traces tab 3 To view the total current for the run check the Total Current check box To display current for indiv...

Страница 202: ...click the pin to pin the result Upon reanalysis a new tab containing the reanalyzed results will be created Performing a Batch Analysis To analyze more than one sample simultaneously perform the follo...

Страница 203: ...Batch To skip the currently executing analysis of a sample while a batch analysis is running select Analysis Skip Current Sample from the menu Skipping the Current Sample Set Analysis in a Batch To sk...

Страница 204: ...on the Compare button on the Sample View toolbar to open the Compare dialog box 5 Select up to fifteen results and click OK 6 The system will process all fifteen results and the original result and w...

Страница 205: ...e icon 16 Select a point in the original result 17 Select points in the other results you wish to align with the point in the original result 18 Access the Display Options dialog box by double clickin...

Страница 206: ...ergone final processing to produce result data If the data has been analyzed using a sequence analysis parameter set the data with each peak assigned a base is printed Result Output The result output...

Страница 207: ...e the parameters that indicate that any given base is an A C G or T along with a value to indicate the likelihood that the call is correct Trimming Log This log details the parameters used in Quality...

Страница 208: ...Sequence Analysis Procedures 194 CEQ 8000 Genetic Analysis System Figure 119 Sequence Results Report...

Страница 209: ...e Quality Parameters then click OK Figure 120 Report Format Dialog Box 3 To view the Quality Parameters of an analyzed data set prior to printing go to the File menu and select Print Preview To exit t...

Страница 210: ...se identity score assigned by the base caller ranging from 0 255 C base identity score assigned by the base caller ranging from 0 255 G base identity score assigned by the base caller ranging from 0 2...

Страница 211: ...g Result Data with Result Output To synchronize the Analyzed Data with the Base Sequence perform the following steps 1 Access the Sequence Analysis module 2 Open the desired analyzed data 3 Select Too...

Страница 212: ...r text into the Base Sequence pane to hear the letter bases announced as they are typed To enter text in the Base Sequence pane Edit mode must be enabled Using Audio Playback To enable the audio playb...

Страница 213: ...he desired name and click OK Computing a New Color Calibration To compute a new color calibration perform the following steps 1 Select Analysis Working Analysis Parameters 2 In the Working Parameters...

Страница 214: ...odule follow the steps below 1 Launch the Sequence Analysis application and open a sequence result 2 Select File Export to open the Export dialog box 3 Select a target folder and file name 4 Select th...

Страница 215: ...nnot currently view raw data current or voltage However custom applications can be written to view the data Use the SCF format to transfer data from instrument to instrument or to import data from thi...

Страница 216: ...directly into PHRAP PHRED phd 1 The PHRED format will produce two files a PHRED file and an SCF file A PHRED file is a text file composed of a SEQUENCE section containing a COMMENT and DNA section The...

Страница 217: ...ent Analysis Parameter CQF Galvo Scan Data CQG Fragment Locus Tags CQL Method CQM SNP Locus Tag CQN Sequence Result CQR Sample Data CQS Sample Table CQT Fragment Result CQU Sample Table Result CQX Rem...

Страница 218: ...extension add or modify the entry with the desired file extension do not place the leading dot the system will add it SCF_EXT scf v3 Output FileName SpaSample scf v3 4 To hide an entry and make the s...

Страница 219: ...propriate Export Data Format radio button and then click OK 3 Select Analysis Third Party Analysis from the menu 4 In the Export dialog box enter the filename and then click OK The data will be export...

Страница 220: ...Sequence Analysis Procedures 206 CEQ 8000 Genetic Analysis System...

Страница 221: ...file from the Sequence Analysis Module export the data in seq format or choose txt with only Result Output checked To enter known protein or nucleotide mutations perform the following 1 On the line b...

Страница 222: ...en you create a new comparison navigate to the appropriate folder to select your reference Selecting a Reference and Sequence Results Open the CEQuence Investigator application and select File New or...

Страница 223: ...lts and press OK To select two results highlight the first result hold the Ctrl button down and use the left mouse button to highlight second result Figure 124 Open Sequence Results Dialog If two resu...

Страница 224: ...toolbar Numbering Base and codon numbering start at the beginning of the reference sequence They are used as a navigational reference point The column position numbering begins at the first base in t...

Страница 225: ...don Each codon will be shaded to show its boundaries If an inserted space exists signified by a dash the space will be included in the codon The amino acid designation is left justified above the codo...

Страница 226: ...trace pane and select Unzoom Pane The selected trace will be unzoomed to display the entire range of the result You cannot edit sequence traces in Sequence Investigator However sequence traces can be...

Страница 227: ...ty bases will be identified in the Differences line the Navigator toolbar and the Discrepancy Map Viewing CEQuence Investigator Differences The system uses codes to denote the type of discrepancy enco...

Страница 228: ...n then check the Navigator option The Navigator toolbar is displayed Figure 126 Navigator toolbar Trim operations must be completed before any other editing After any other editing the trim feature wi...

Страница 229: ...on will appear in the alignment pane You can then trim the ends of the sequences If sequences are not shown select View Sequences to display the sequences in the alignment pane To trim the sequence se...

Страница 230: ...overlapping base That is a search for the ambiguity code K will not only result in the bases G or T but will also result in any ambiguity code that contains G or T In fact the search would stop on al...

Страница 231: ...ed regions of interest associated with the specified attributes A red marker behind the reference sample and consensus bars corresponds to the selected area in the trace data view and the selected bas...

Страница 232: ...f the compared sequence and the name of the sample sequences as well as the database and project where the sample resides Alignment The Alignment Results portion of the report prints the reference ami...

Страница 233: ...he Preferences dialog box under the File menu If you specify Condensed all protein translations will be provided in the same text line Heterozygotes will be designated within brackets If you specify E...

Страница 234: ...location Press Save and the data is saved to the flat file for later retrieval If the document has previously been saved select File Save from the menu toolbar and the document will be saved immediate...

Страница 235: ...ewed exported and printed Analyzing fragment or allele data with the CEQ System software is readily carried out with the use of Studies A Study represents a collection of quality sample results used f...

Страница 236: ...a set of multiple sample results together with the results of analyses performed on the group of sample results Creating a new Study can be easily carried out with the help of the Study Wizard The St...

Страница 237: ...Studies tab The Date Time column indicates when the Study was created or last modified When you have made your selection click OK to open the existing Study Selecting the Components of the New Study T...

Страница 238: ...ight clicking on a highlighted sample and selecting the Show Single Sample View command from the menu displayed The List View and Plate View tabs provide you with two methods of making your raw data s...

Страница 239: ...ed area 6 To select all of the displayed samples to be included in your Study click the right double arrow button to move them to the Raw Data Selected area 7 To remove samples from your Study click t...

Страница 240: ...2 Once you have selected a project the Plates list box will contain all of the sample plates available for that project Click on the down arrow located on the right side of the Plates list box to dis...

Страница 241: ...n added to the Raw Data Selected area 7 When you have finished making your selections click Next to proceed to the Analysis Parameters window Selecting an Analysis Parameter Set The second step in cre...

Страница 242: ...is Study 3 When you have made your selection click Next to proceed to the Analyze Data window If the available parameter sets are not applicable to your Study you will need to create a new set of anal...

Страница 243: ...you the option to add additional result data to your new Study Additional result data may include samples that were previously analyzed under a different set of analysis parameters than those analyze...

Страница 244: ...parameters select an analysis method to be used assign quantitation values and define several other factors that will affect how your data will be analyzed The Fragment Analysis Parameters window can...

Страница 245: ...ting a new parameter set input a descriptive name in the Parameter Set Name field and select the project under which the parameter set will be located 2 If you are editing an existing parameter set yo...

Страница 246: ...unknown peaks must meet before being displayed in the fragment list or annotated in fragment trace data Enter a value between 0 100 The default value is 10 The unknown peaks above this set value relat...

Страница 247: ...elate the known fragment size to either migration time or mobility in order to estimate the size of the unknown fragment s When creating a new size standard there are two requirements that help the sy...

Страница 248: ...s of the standard fragments determined from a large number of repeated runs This parameter is sometimes called the lack of fit 4 Select the empirical model that will be used to generate the curve that...

Страница 249: ...t velocity cm s divided by the separation potential V cm with the sizes of the standard fragments to construct a size calibration Fragment Analysis Parameters Quantitation Tab This tab allows you to s...

Страница 250: ...Area option the software will calculate the quantity of your reference peak based upon its peak area Quantitation Values 3 Select the check box for each dye with which you are using a reference peak F...

Страница 251: ...cus tags to meet the specific requirements of your samples Locus tags are used to define a particular locus of interest Each available locus tag has been configured with a specific set of parameters t...

Страница 252: ...n to move the selections to the right selected frame 3 To remove locus tags from your parameter set click to highlight the locus tag s in the right selected frame and click either of the left arrow bu...

Страница 253: ...roup of sample data being selected for the Study SNP locus tags are much the same in many respects as STR locus tags Each SNP locus tag is configured with a specific set of parameters that tell the so...

Страница 254: ...ng locus tags SNP analysis will only take place if the following 3 criteria are met 1 SNP Locus Tags have been selected as part of the analysis in the SNP Locus Tags tab of the Analysis Parameters win...

Страница 255: ...rameters window Advanced tab Mobility 1 Select the desired Dye Mobility Calibration from the drop down list box The Dye Mobility Calibration is used to select a specific calibration from the options a...

Страница 256: ...determined it can be saved as a standard mobility reference to aid in the identification of standard fragments in subsequent analyses of different samples using the same standard If you have an existi...

Страница 257: ...d the Dye check boxes for each dye trace you would like to be generated With this option selected no attempt will be made to estimate the dye spectra from the sample being run and only the selected sy...

Страница 258: ...tabs for creating or editing locus tags the Locus Tag tab and the Allele ID Criteria tab The locus name and project location are displayed at the top of the window New or edited locus tags can be sav...

Страница 259: ...bel the identified alleles in the fragment list For example the alleles can be labeled the same as their expected fragment size in nucleotides 163 164 167 etc in alphabetic order A B C etc or in simpl...

Страница 260: ...he Generate Allele List button The system generates an allele list from the information provided by the user The allele list starts at the low end of the fragment length range and creates an allele at...

Страница 261: ...calculated Linear Regression calculates the line of best fit for the selected alleles The line is then used to determine the apparent sizes for all points not selected This option requires that more...

Страница 262: ...isplayed is dependent on the overall standard deviation computed in the bin analysis and the user specified confidence level default 95 When the confidence interval is manually entered by the user the...

Страница 263: ...window allows you to set the parameters for which the system will identify these peaks as stutter and not as true alleles 1 Select this check box if you want the system to search for stutter When sel...

Страница 264: ...ends of PCR products What results is a mixture of PCR products of different lengths from a single allele Some of these products are templated true length called A products while others are one nucleo...

Страница 265: ...fragment list as an unknown allele If the Detect Spurious Peaks check box has been selected and the peak falls below the maximum height designation for spurious peaks the other peak will be included...

Страница 266: ...dditionally it is generally a good idea to check the Detect A option so the software will correctly categorize peaks If the option is incorrectly configured the alleles will still be identified but th...

Страница 267: ...ield This is the locus tag name that will be displayed in the fragment list for all fragments that are identified as belonging to this locus The Apparent Fragment Size must be a real number greater th...

Страница 268: ...on fragment mobilities Therefore it is important that the apparent size entered into the SNP locus tag definition is a known value This is best determined in preliminary runs as the average apparent s...

Страница 269: ...f exclusions that you apply to the data will filter out all unwanted results from your Study This process is known as Result Set Filtering Accessing the Result Set View The Result Set View can be view...

Страница 270: ...ter Set is to exclude any results that do not meet the criteria of the Study and to include results that do For example suppose that your result set contains multiple samples collected under two diffe...

Страница 271: ...er set parameters The number of results that are included in result set within each sample capillary A H is displayed As samples are filtered out of the result set by the exclusion filters they are mo...

Страница 272: ...Sample View displays all of the available information for an individual data sample including the collected trace views fragment data separation and analysis parameters the calibration curve the run l...

Страница 273: ...ysis of the selected result The analysis log contains information that can be useful in determining the cause of an analysis failure Run Log Displays the list of messages generated by the CEQ instrume...

Страница 274: ...ific to the selected result i e sample name dates database location hardware information etc Property Set Displays a list of user defined property fields and the values associated with the selected re...

Страница 275: ...u to draw a rectangular box around a selected area to zoom into The second mode toolbar buttons allows you to select a group of traces and add them to a Stacked Graph view To access this function righ...

Страница 276: ...he application of filter sets will be shaded in a teal color Manually excluded results will be shaded in a maroon color Results excluded with either of these methods may be re included at any time thr...

Страница 277: ...lts command from the menu displayed This command is also available from the Analysis menu Re analyzing Results 1 Select one or more results from the Result Set View 2 Right click on the highlighted re...

Страница 278: ...ck the Stop button The system will stop the re analysis when it has finished with the sample in progress 9 When the re analysis is complete the status column will indicate if the re analysis succeeded...

Страница 279: ...List can also be accessed from the Data tab of the Study Explorer The Fragment List window will be displayed Figure 148 Fragment List window The Fragment List displays a table of all analyzed fragmen...

Страница 280: ...ilter out fragments in which no confidence interval was estimated those with asymmetric peaks stutter peaks etc The end result of this third level filtering is to leave you only sample data with fragm...

Страница 281: ...the y axis of each plot selected is independently scaled based on the available data To access this function right click on the highlighted sample s from the fragment list and select the Show Stacked...

Страница 282: ...ist or update an existing allele list for a locus tag based on the collection of fragment results When bin analyses are performed the system groups fragments by size to form bins characterized by an a...

Страница 283: ...ot This plot consists of all of the analyzed fragment data displayed as a function of the peak height y axis and fragment length x axis 1 Select the dye that was used for the analysis of the raw data...

Страница 284: ...the results selected in the creation of the study The bins are defined and visible with the majority of the result points within their borders Each trace from which the points in the bin were derived...

Страница 285: ...point will be displayed for visual comparison to other points The visual comparison of the two traces will help you to confirm the assignment of the data point to an already defined bin or to a new b...

Страница 286: ...ction of this manual or the Online Help for more information about locus tag parameters The system saves the following information Observed Size bin mean Bin Minimum Maximum Standard Deviation of Data...

Страница 287: ...dividual samples see Single Result View Stacked View Overlay manually include or exclude individual samples or groups of samples from the analysis see Add or Remove Results and Re Analyze selected sam...

Страница 288: ...calculated From the Analysis menu select the New Peak Ratio command The New Peak Ratio window will be displayed Figure 153 New Peak Ratio window The Peak Ratio window displays all of the result data...

Страница 289: ...o to reach before it considers the ratio to be variant Select the Error option button to enable the system to base its criteria for identifying any variant ratios on the percentage of error Input the...

Страница 290: ...to the top of the Fragment Result Set Traces area of the window to distinguish it as the reference result trace To de select the reference result right click on the reference result and select the Se...

Страница 291: ...sub menu and de select the Reference command unchecked Selecting a Test Peak A test peak is a trace peak selected by the user from the reference result trace The test peak is compared to the referenc...

Страница 292: ...alysis program that scores the presence or absence of a fragment of a given size per sample Using the AFLP feature The AFLP feature takes all results from the Study and creates bins from fragments wit...

Страница 293: ...with size rounded to the next integer The Y Threshold parameter serves as a exclusion filter defining the lowest acceptable value peak height for the y axis Set the y threshold in relative fluorescenc...

Страница 294: ...System If the results list contains samples with fragments with more than one dye either multiple dye labeled fragments pooled in a sample or multiple samples with single dye labeled fragments in each...

Страница 295: ...l be assigned if two adjacent bins fall in the same integer after rounding of the Bin X Mean The Dye Column Row displays the dye included The Samples Column Row displays the sample count within the bi...

Страница 296: ...f you would like to exclude samples that have no qualifying peaks Select the Show Excluded Elements check box to highlight all fragment data that was excluded from the analysis The Maximum Bin Width a...

Страница 297: ...e Format for file export The Dyes parameters determine the dye color to be used by the system during the cluster analysis If the results list contains samples with fragments with more than one dye eit...

Страница 298: ...s identified in similarly named samples are then compared and their status determined LOH AI MI Homozygous NoNorm Alleles You must have Enable Macros selected to run the LOH Analysis You will receive...

Страница 299: ...aved correctly Additionally the file name must be changed from the default name displayed in the Save As dialog otherwise the result will be saved as a temporary file and will be overwritten in the ne...

Страница 300: ...s a list of all possible columns that can be displayed in the list These columns can be selected individually or in groups they can be arranged in any order and can be locked so that they always remai...

Страница 301: ...displayed in the fragment result table Locking the Column Position Selected columns can be locked into position so that they remain in view as you scroll across the remaining columns in the results l...

Страница 302: ...Peak Ratios tables Sorting an Individual Column Right click on the column header of the column you want to sort to display the pop up menu Select the Sort Column command The column will be sorted in...

Страница 303: ...User s Guide 289 More information on these and other display modifications can be found in the Online Help...

Страница 304: ...New Report window allows you to select the type of report you would like to generate from a list of available report templates see Report Templates on page 291 and saved data The New Report window ca...

Страница 305: ...ect the report template from the Template drop down menu The selections available depend on the Context Type Click OK to display the new report containing the selected information Report Templates The...

Страница 306: ...cts that follow Data object descriptions highlighted in gray can be removed but should not be edited because they are very specifically coded to extract data from the database Do not overwrite the ori...

Страница 307: ...e graph placeholder 2 Select Format Object 3 Go to the Web tab and create the following text DisplayOptions Your commands will go here Editing X scale type The possible values for XScaleType are Defau...

Страница 308: ...Pane Width Only one of PaneCount or PaneWidth should be specified If PaneCount is specified it represents the number of panes that the graph will be broken into If neither PaneCount nor PaneWidth is s...

Страница 309: ...ill not affect this option The possible value for selectedDyes are all 1 2 3 4 or combination of 1 2 3 4 All means display all four dyes By default the display for the four dyes is 1 D1 2 D2 etc In th...

Страница 310: ...The Export Results window will be displayed Figure 160 Export Results The first step involves selecting the results to be exported from a list of available results located in various projects Select t...

Страница 311: ...tion regarding the sample and run conditions with the exported results Select the Raw Data option button to include raw data with the exported results Select the Result Data option button to include d...

Страница 312: ...Tab Delimited txt in the Save as type text box Make sure Header is selected in the Sample Elements section Click Export Now navigate to the target folder and double click on the exported file to open...

Страница 313: ...he sample name These are generated by the CEQ System Software Check Resolve Filename Conflicts to enable the system to increment the sample name s on export if it encounters a sample s with the same n...

Страница 314: ...f the Study s fragment list as selected sorted and ordered Each line in the output file represents a fragment The data in this export are comma delimited suitable for viewing in most 3rd party spreads...

Страница 315: ...DMPopulation file log a list of processing steps and errors encountered during the export The DMPopulation export requires a list of locus names in a file named LocusList txt This file must be stored...

Страница 316: ...LocusList txt is required to create the Genotype Summary Report GSV and to perform some exports The locus list editor is used to customize the LocusList txt file To open the Editor press the F7 key o...

Страница 317: ...ected Loci list Moves only the selected loci from the Study Loci and Other Loci list to the Selected Loci list Moves all loci from the Selected Loci list to the Study Loci or Other Loci list If the lo...

Страница 318: ...Fragment Analysis Procedures 304 CEQ 8000 Genetic Analysis System...

Страница 319: ...atabase perform the following steps 1 In the Data Manager window select File New Database 2 In the New Database dialog box enter the name for this new database select Set as Working Database if desire...

Страница 320: ...roject folder or database 2 Select File Rename from the menu bar 3 Enter the new name for the database and press the Enter key Database Size The database size is displayed in the Database Manager To v...

Страница 321: ...tely reduce in size Use this option to manually shrink the database to its new smaller size This is useful before a database is backed up You cannot shrink a database while simultaneously performing a...

Страница 322: ...educing the risk of losing data If a database is deleted or damaged only the data created since the last backup will be lost Backups can be saved to any folder on a local drive Follow the Shrink Datab...

Страница 323: ...the location on the local disk to save the backup file 5 Accept the file name or rename it as necessary Typically databases are frequently backed up It may be prudent to add the date as part on the na...

Страница 324: ...usly saved using the backup procedure If you are restoring a database that has the same name as one already residing in the Database Manager you must either restore it with a new name or delete the ex...

Страница 325: ...Restore Database User s Guide 311 2 Mouse click in any window 3 Select the Tools Restore Database menu item Figure 173 Data Manager Figure 174 Restore Database menu item...

Страница 326: ...e to restore and click Restore If a database with the same name exists a warning will appear Figure 176 If this occurs click OK and either Delete the database in the Data Manager NOT recom mended or R...

Страница 327: ...t is the Working Database 2 Select Tools Convert Individual ID to Subject ID see Figure 177 The conversion takes place in the background and the message Conversion Completed Successfully message will...

Страница 328: ...ialog in Figure 179 will appear if any of the sample results are missing This dialog box provides a list of the sample results that were not exported Figure 179 Sample Results Missing Dialog A maximum...

Страница 329: ...Exporting Database Items User s Guide 315 Figure 180...

Страница 330: ...anager Module follow the steps below 1 Launch the Data Manager and open a sequence result 2 Select File Export to open the Export dialog box 3 Select a target folder and file name 4 Select the desired...

Страница 331: ...this format for instance to export analyzed sequence data into Lasergene s SeqMan from DNASTAR Inc Third Party packages cannot currently view raw data current or voltage However custom applications ca...

Страница 332: ...into PHRAP PHRED phd 1 The PHRED format will produce two files a PHRED file and an SCF file A PHRED file is a text file composed of a SEQUENCE section containing a COMMENT and DNA section The SEQUENCE...

Страница 333: ...the file and is able to retain all of the information belonging to that file This format can only be used when importing data into the Data Manager This format can also be used when exporting data fro...

Страница 334: ...dule Individual files are created representing individual colors FileName _D1 crv D1 contains dye 1 red FileName _D2 crv D2 contains dye 2 black FileName _D3 crv D3 contains dye 3 green FileName _D4 c...

Страница 335: ...amples Run field e Print a report of all samples run during the specified dates by selecting the Print button Administrative Tools This version of CEQ Software allows users to access the database with...

Страница 336: ...ve Tools Computer Management The Computer Management console shown in Figure 182 will be displayed Add New Users following the steps below 1 Mouse click on the symbol to the left of the System Tools i...

Страница 337: ...e 184 enter the new User name required and edit the other fields as necessary 5 Click Create Adding Groups 1 Mouse click on the symbol to the left of the System Tools item if needed 2 Mouse click on t...

Страница 338: ...roup name CEQUSERS and a description if necessary 5 Click the Add button to add the users created in the Adding Users section above 6 The Select Users or Groups dialog will open The local computer wil...

Страница 339: ...n the Adding Users section above If more than one User was created mouse click on the first name press and hold the Ctrl key on the keyboard and select any additional names to add to the group 8 Click...

Страница 340: ...added removed at any time thereafter The steps below describe the activation process Be sure the steps outlined in Adding Users on page 322 and Adding Groups on page 323 are completed before continuin...

Страница 341: ...Control window Use Figure 190 User Accessible Hardware Components to locate hardware components referenced in this section Figure 190 User Accessible Hardware Components HV LASER PWR 900463 AI Capilla...

Страница 342: ...ide 5 Rotate the Wetting Tray Retainers outwards to release the Wetting Tray 6 Lift the Wetting Tray vertically Installing the Wetting Tray 1 Select Replenish Replace Wetting Tray from the Run Module...

Страница 343: ...tting Tray 6 Close the Sample Access Cover and then click the Done button in the Replace Wetting Tray dialog box Figure 192 Figure 192 Replace Wetting Tray Dialog 901002L A Wetting Tray Well front Sam...

Страница 344: ...g turns green 4 Open the Sample Access Cover Figure 190 and lift to the vertical locking position If Sample Plate was selected skip to Loading the Sample Plate If Buffer Plate was selected skip to Loa...

Страница 345: ...exposed to the air for more than 15 minutes Figure 196 Capillaries Exposed Dialog Loading the Buffer Plate and Evaporation Cover 1 Align the notched corner of the Buffer Plate with the alignment line...

Страница 346: ...Capillaries Exposed dialog box Figure 196 Specifying Capillary Temperature 1 Select Direct Control Capillary Temperature from the menu 2 In the Capillary Temperature dialog box a Enter a capillary ho...

Страница 347: ...l Gel Capillary Fill from the menu 2 From the Gel Capillary Fill dialog box select the Buffer Plate or Wetting Tray radio button to identify the position where waste will be expelled from the capillar...

Страница 348: ...illary array along with the samples that used the array c The system automatically updates the date and time installed d Change the number of runs imparted on the capillary array since it was installe...

Страница 349: ...buffer part number b The system automatically updates the date and time installed c Use the spin control to change the Hours on Instrument if you wish to change the system s alert mechanism 4 When fin...

Страница 350: ...Release Capillary Array from the Run menu After the system prepares for release of the capillary array the Remove Capillary Array dialog box Figure 200 is displayed Figure 200 Remove Capillary Array D...

Страница 351: ...as the electrode block may disengage from its mounting posts and become damaged Figure 202 Plenum Assembly Removal 7 Lift the Eject Lever Figure 203 to release the Array Fitting Manifold Access Cover...

Страница 352: ...Plate c Hold and wait five seconds for the gel strand to dry d Pull the fitting away from the instrument e Wipe gel strands off of the instrument using a damp tissue Note the number of runs and days...

Страница 353: ...ut and away from the instrument Figure 204 Removing Replacing the Electrode Block 7 From the Remove Capillary Array dialog box Figure 200 select the Replace Capillary Array radio button and click OK 9...

Страница 354: ...he fitting into the manifold until it is completely seated against the bases of the Guide Pins Make sure that the fitting tab is placed downward when inserting the capillary array into its slot 9 Whil...

Страница 355: ...ssembly without any constriction 11 Replace the Plenum Assembly and tighten the two captive screws Figure 202 12 Replace the Manifold Access Cover and tighten the captive screw Figure 201 13 Lower the...

Страница 356: ...runs or the number of days on the instrument as they will be correct If you are installing a capillary array that was previously used but not the last capillary array on the instrument enter its part...

Страница 357: ...dge is being removed for storage purposes and being replaced with the gel pump plug 1 Select Replenish Release Gel Cartridge from the Run menu When the system is ready to release the gel cartridge the...

Страница 358: ...note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session 5 If necessary use a tissue to wipe gel strands off of the instrument 9...

Страница 359: ...w cartridge or the gel pump plug into the barrel and lock it into position by aligning the cartridge wings with the cartridge holder and pushing in 8 Push the cartridge locking lever towards the back...

Страница 360: ...you are installing the previous gel cartridge do not change the lot number or the hours on the instrument as they will be correct c If you are installing a previously used gel cartridge but it was not...

Страница 361: ...that the Manifold Plug is being removed in preparation for Capillary Array installation 1 Select Replenish Release Capillary Array from the Run Module main menu wait for the Remove Manifold Plug dialo...

Страница 362: ...he manifold b Touch the tip of the plug to the bottom of the Optics Base Plate c Hold and wait five seconds for the gel strand to dry d Pull the plug out and set it aside for future use e Wipe gel str...

Страница 363: ...ck OK from the Remove Manifold Plug dialog box Figure 214 Figure 214 Remove Manifold Plug Dialog 7 To install the capillary array see Removing and Replacing the Capillary Array on page 336 901290L AI...

Страница 364: ...Direct Control and Replenishment 350 CEQ 8000 Genetic Analysis System...

Страница 365: ...ystem Routine Maintenance Use Figure 215 to locate hardware components referenced in this section Figure 215 User Accessible Hardware Components HV LASER PWR 900463 AI Capillary Access Cover Capillary...

Страница 366: ...lift to the vertical locking position 4 Unlatch the two rubber latches holding the Capillary Temperature Control Cover and lift to the vertical locking position 5 Loosen the Manifold Access Cover cap...

Страница 367: ...e array fitting in hand blow dust and debris off of the windows with compressed gas Texwipe Microduster III P N TX2511 9 Using a water moistened swab Texwipe Swab P N TX754B gently wipe the Detection...

Страница 368: ...dry swab 12 Blow compressed gas on the windows to remove all excess water Care must be taken not to invert the compressed gas bottle otherwise propellant will contaminate the capillary windows 13 If...

Страница 369: ...until it is completely seated against the bases of the Guide Pins See Figure 217 16 Replace the Manifold Access Cover and tighten the captive screw 17 Lower the Capillary Temperature Control Cover an...

Страница 370: ...bottle into position 6 Close the Sample Access Cover 7 Dispose of the full waste bottle according to procedures found in Disposal of the Gel Waste Bottle on page 361 Replacing the Wetting Tray Remove...

Страница 371: ...ray 1 Rotate the wetting tray retainers outward 2 Insert the Wetting Tray into the receptacle between the Sample and Buffer plates Figure 221 and then gently press it down into the well 3 Rotate the W...

Страница 372: ...andling hazardous chemicals and biological waste Disposal of Formamide from the Sample Plate Multi Channel Pipettor When performing this procedure use an exhaust ventilation unit that meets TLV requir...

Страница 373: ...le federal state and local environmental regulations concerning hazardous liquid waste Disposal of Buffer Gel Mixture from the Buffer Plate Multi Channel Pipettor When performing this procedure use an...

Страница 374: ...e federal state and local environmental regulations concerning hazardous liquid waste Disposal of the Capillary Array After removing the expended capillary array from the instrument dispose of it in a...

Страница 375: ...mental regulations concerning hazardous liquid waste Disposal of the Gel Waste Bottle When performing this procedure use an exhaust ventilation unit that meets TLV requirements Dispose of buffer gel m...

Страница 376: ...Sequencing Kit for 96 reactions in a single tube containing DNA polymerase CEQ Dye Terminators ddUTP ddGTP ddCTP ddATP dNTP Mix Solution Sequencing Reaction Buffer pUC18 Control Template 47 Sequencing...

Страница 377: ...etector array fitting Ready for installation into CEQ 8000 CEQ Separation Gel LPA 1 608010 1 11 5 mL of gel in CEQ 8000 compatible container Sufficient for 12 fills of the Capillary Array 96 sequencin...

Страница 378: ...d terminators ddUTP ddGTP ddCTP ddATP Reaction buffer Mineral oil Sufficient for 96 reactions CEQ Sample Loading Solution SLS 608082 1 Sample Loading Solution SLS 6 0 mL Buffer Plates 609844 Box Packa...

Страница 379: ...or plates with caps Thermal cycler with heated lid CEQ Sample Loading Solution SLS Mini Alpha Swab from Texwipe P N TX754B VWR Microduster III AccTech P N 58019 538 VWR 20 mg mL Glycogen Boehringer Ma...

Страница 380: ...Routine Maintenance 366 CEQ 8000 Genetic Analysis System...

Страница 381: ...Diagnostics from the Run menu 2 From the Diagnostics dialog box select the PC Settings button 3 View the settings in the PC Communication Settings dialog box and then exit the dialog box Viewing Instr...

Страница 382: ...eline from the Run Module main menu 2 From the Monitor Baseline dialog box a Select the Enable Monitor Baseline check box b Select the Autosave check box to save monitor baseline data c Enter a name i...

Отзывы: